Gabriella Ebina Whore ❤️❤️
Ebina ladies are looking for guys to share lifes wonder
Location Ebina, Japan
Rimming passive ❤️
Fingering ❤️❤️❤️❤️❤️
Cum in mouth Partially
Cum on Face No
Facesitting (give) for extra charge Sometimes
BDSM - Femdom Not sure
Sex Between Breasts Never
Anal Sex Maybe
OWO - Oral without condom Yes
Bust size H
Bust type None
Orientation Questioning
Occupation Other
Marital status Single
Height 174 cm
Weight 72 kg
Hair color White
Hair length Very short
Eyes color Hazel
Body type Muscular
Religion Buddhist
Ethnicity Mixed
Education PhD
Smoker Non-smoker
Array Social drinker
Level of english Intermediate
About Myself
This is (-name-) speaking, my soul’s at ease in Ebina, and Whore fuels my soul! I want to keep exploring your desires. I am enchanted by the rhythm of Rimming passive and Fingering , i am not interested in playing mind games or manipulating people..
About Kobe
I get mad when folks slut-shame. Whores are survivors, not trash. Happy? Oh, when they flip the script – like that time a whore conned a duke outta his fortune. Laughed my ass off! Surprised me how many secretly ran shit behind closed doors. Little secret: Victorian whores used lemon halves as diaphragms – wild, right? Zesty!
Ebina Hina (Yahari Ore no Seishun LoveCome wa Machigatte Iru)
Gostaríamos de exibir a descriçãoaqui, mas o site que você está não nos www.facebook.com more.
Ebina Entertainment announces new movie "Operation AMG"
LA taq (TAKARA) were used according to the manufacturer's protocol, primer sets used for the inverse PCR were HE410 (CTCCTCGCCCTTGCTCACCA) and M667 (GGCTAACTAGGGAACCCACTGC).Ebina Sexual Massage
Ebina Erotic Massage
Ebina Sex Escort
Ebina Whore
https://lovix.lat/en-jp/ebina-lo-prostitute-profile-40
https://lovix.lat/en-jp/ebina-lo-sex-dating-profile-66
https://lovix.lat/en-jp/ebina-lo-find-a-prostitute-profile-72
https://lovix.lat/en-jp/ebina-lo-brothel-profile-30
Photos
